Bán tài liệu, giáo án tất cả các môn toán, lý,hoá,sinh,văn,sử,địa,tiếng anh, công dân,
Phần mềm bán hàng toàn cầu

Đột biến gen sinh học 12

Chủ nhật - 27/12/2020 05:02
Đột biến gen sinh học 12, Các dạng đột biến gen, Sinh học 12 Bài 4: đột biến gen violet, Lý thuyết đột biến gen, Sinh học 12 Bài 5, Soạn sinh bài đột biến gen, Cơ chế phát sinh đột biến gen, Sinh học 12 Bài 6, Bài 4: đột biến gen trắc nghiệm, Thế nào là đột biến gen, Nguyên nhân đột biến gen, Hậu quả đột biến gen
Các dạng bài tập sinh học 12
Các dạng bài tập sinh học 12
Đột biến gen sinh học 12, Các dạng đột biến gen, Sinh học 12 Bài 4: đột biến gen violet, Lý thuyết đột biến gen, Sinh học 12 Bài 5, Soạn sinh bài đột biến gen, Cơ chế phát sinh đột biến gen, Sinh học 12 Bài 6, Bài 4: đột biến gen trắc nghiệm, Thế nào là đột biến gen, Nguyên nhân đột biến gen, Hậu quả đột biến gen, Ví dụ về đột biến gen ở thực vật, Vai trò của đột biến gen, Biểu hiện của đột biến gen, Khái niệm đột biến gen, Sự phát sinh đột biến gen phụ thuộc vào

I. KHÁI QUÁT VÀ CÁC DẠNG ĐỘT BIẾN GEN

1. Khái niệm

- Là những biến đổi nhỏ trong cấu của gen liên quan đến 1 (đột biến điểm ) hoặc một số cặp nu.
- Đa số đột biến gen là có hại, một số có lợi hoặc trung tính.
- Đặc điểm:
+ Mỗi lần biến đổi gen tạo ra 1 alen mới.
+ Tần số đột biến gen tự nhiên là rất thấp (10(-6) - 10(-4)).
- Tác nhân gây đột biến gen:
+ Tia tử ngoại
+ Tia phóng xạ
+ Chất hoá học
+ Sốc nhiệt
+ Rối loạn qúa trình sinh lí, sinh hoá trong cơ thể
- Thể đột biến: là những cá thể mang đột biến đã biểu hiện ra kiểu hình của cơ thể.

2. Các dạng đột biến gen

Dạng đột biến Đột biến thay thế một cặp nucleôtit Đột biến mất hoặc thêm một cặp nucleôtit
Đặc điểm Làm thay đổi trình tự a.a trong prôtêin và thay đổi chức năng của prôtêin. Làm thay đổi trình tự a.a trong prôtêin và thay đổi chức năng của prôtêin.
- Làm thay đổi trình tự aa trong chuỗi pôipeptit và làm thay đổi chức năng của protein.

II. NGUYÊN NHÂN VÀ CƠ CHẾ PHÁT SINH ĐỘT BIẾN GEN

1. Nguyên nhân
- Do tác động lí, hóa, sinh học ở ngoại cảnh.
- Do những rối loạn sinh lí, hóa sinh trong tế bào.

2. Cơ chế phát sinh đột biến gen.

a. Sự kết cặp không đúng trong nhân đôi ADN.
- Các bazơ nitơ thường tồn tại ở 2 dạng cấu trúc: dạng thường và dạng hiếm.
+ Các dạng hiếm (hỗ biến) có những vị trí liên kết hiđrô bị thay đổi làm cho chúng kết cặp không đúng khi nhân đôi, từ đó dẫn đến phát sinh đột biến gen.
VD.
Lý thuyết Sinh học 12 Bài 4: Đột biến gen | Lý thuyết Sinh học 12 đầy đủ, chi tiết nhất

b. Tác động của các nhân tố đột biến

- Tác động của các tác nhân vật lí: Tia tử ngoại (UV) làm cho 2 bazơ Timin trên 1 mạch ADN liên kết với nhau làm phát sinh ĐBG.
- Tác động của các tác nhân hóa học: 5-Brôm Uraxin là đồng đẳng của Timin gây thay thế A-T → G-X.
- Tác nhân sinh học: Virut gây ra đột biến.
Lý thuyết Sinh học 12 Bài 4: Đột biến gen | Lý thuyết Sinh học 12 đầy đủ, chi tiết nhất
III. HẬU QUẢ VÀ VAI TRÒ CỦA ĐỘT BIẾN GEN.
1. Hậu quả của đột biến gen.
- Đột biến gen có thể gây hại, vô hại hoặc có lợi cho thể đột biến.
- Mức độ gây hại của các alen đột biến phụ thuộc vào điều kiện môi trường cũng như phụ thuộc vào tổ hợp gen.
2. Vai trò và ý nghĩa của đột biến gen.
- Đột biến gen cung cấp nguyên liệu cho quá trình tiến hóa và chọn giống, cho nghiên cứu di truyền.
B. Bài tập rèn luyện kỹ năng
Câu 1: Đột biến điểm là những biến đổi trong cấu trúc của gen xảy ra tại
A. một điểm nào đó trên phân tử axit nucleic, liên quan tới một hoặc môt vài cặp nucleotit.          
B. một điểm nào đó trên phân tử axit nucleic, liên quan tới một hoặc môt vài nucleotit.    
C. nhiều điểm trên phân tử axit nucleic, liên quan tới một số cặp nucleotit.       
D. một điểm nào đó trên phân tử ADN, liên quan tới một cặp nucleotit.
Hướng dẫn giải:
Đáp án: D
Câu 2: Sự khác nhau giữa đột biến và thể đột biến là:
A. đột biến là những biến đổi trong vật chất di truyền, còn thể đột biến là cơ thể mang đột biến đã biểu hiện ra kiểu hình.                          
B. đột biến là do biễn đổi trong vật chất di truyền, còn thể đột biến là cơ thể mang đột biến gen lặn tiềm ẩn ở trạng thái dị hợp tử.          
C. đột biến luôn xảy ra ở sinh vật, còn thể đột biến chỉ có trong quá trình phân bào tạo ra các giao tử không tham gia thụ tinh.             
D. đột biến là do biến đổi trong vật chất di truyền, còn thể đột biến là cơ thể mang đột biến gen ở trạng thái dị hợp.
Hướng dẫn giải:
Đáp án: A
Câu 3: Một quần thể sinh vật có alen A bị đột biến thành alen a, alen B bị đột biến thành alen b. Biết các cặp gen tác động riêng rẽ và alen trội là trội hoàn toàn. Các kiểu gen nào sau đây là của thể đột biến?
A. aaBb và Aabb               B. AABB và AABb          C. AABb và AaBb            D. AaBb và AABb
Hướng dẫn giải:
Đáp án: A
Giải thích:
Thể đột biến là những cơ thể mang đột biến đã biểu hiện ra kiểu hình → có thể có kiểu gen aa hoặc bb hoặc cả hai sẽ là thể đột biến vì alen A bị đột biến thành alen a, alen B bị đột biến thành alen b.
Câu 4: Sự biểu hiện kiểu hình của đột biến gen trong đời cá thể xảy ra như thế nào?
A. Đột biến gen trội chỉ biểu hiện khi ở trạng thái đồng hợp tử.                          
B. Đột biến gen lặn không được biểu hiện.                
C. Đột biến gen lặn chỉ biểu hiện khi ở trạng thái dị hợp.                                    
D. Đột biến gen trội biểu hiện cả khi ở trạng thái đồng hợp tử và dị hợp tử.
Hướng dẫn giải:
Đáp án: D
Câu 5: Đột biến gen phụ thuộc vào những yếu tố nào?
A. Đột biến gen phụ thuộc vào loại tác nhân đột biến và đặc điểm cấu trúc của gen, không phụ thuộc vào liều lượng, cường độ của loại tác nhân gây đột biến.        
B. Đột biến gen phụ thuộc vào loại tác nhân, liều lượng và cường độ của loại tác nhân gây đột biến, không phụ thuộc vào đặc điểm cấu trúc của gen.                         
C. Đột biến gen không phụ thuộc vào loại tác nhận, mà chỉ phụ thuộc liều lượng, cường độ của loại tác nhân gây đột biến và đặc điểm cấu trúc của gen.                
D. Đột biến gen không chỉ phụ thuộc vào loại tác nhân, liều lượng, cường độ của loại tác nhân gây đột biến mà còn phụ thuộc vào đặc điểm cấu trúc của gen.
Hướng dẫn giải:
Đáp án: D
Câu 6: Hóa chất gây đột biến 5-BU thường gây đột biến gen dạng
A. thay thế cặp G – X bằng T – A.                              B. thay thế cặp G – X bằng cặp X – G.        
C. thay thế cặp A – T bằng T – A.                              D. thay thế cặp A – T bằng G – X.
Hướng dẫn giải:
Đáp án: D
Câu 7: Phát biểu không đúng về đột biến gen là:
A. Đột biến gen làm biến đổi một hoặc một số cặp nucleotit trong cấu trúc của gen.          
B. Đột biến gen làm phát sinh các alen mới trong quần thể.                                
C. Đột biến gen làm biến đổi đột ngột một hoặc một số tính trạng nào đó trên cơ thể sinh vật.      
D. Đột biến gen làm thay đổi vị trí của gen trên NST.
Hướng dẫn giải:
Câu 8: Đột biến gen có thể xảy ra trong quá trình
A. nguyên phân ở tế bào sinh dưỡng và tế bào sinh dục.                                     
B. nguyên phân và giảm phân ở tế bào sinh dưỡng.  
C. giảm phân ở tế bào sinh dưỡng và tế bào sinh dục.                                         
D. nguyên phân ở tế bào sinh dưỡng và giảm phân ở tế bào sinh dục.
Hướng dẫn giải:
Đáp án: D
Câu 9: Một protein bình thường có 500 axit amin. Protein sau đột biến so với protein bình thường bị thiếu đi một axit amin, đồng thời xuất hiện hai axit amin mới ở vị trí của axit amin thứ 350, 351, 352 trước đây. Dạng đột biến gen nào sau đây có thể sinh ra protein biến đổi trên?
A. Thay thế các nucleotit ở giữa các bộ ba mã hóa axit amin thứ 350, 351, 352.
B. Mất 3 cặp nucleotit ở giữa các bộ ba mã hóa axit amin thứ 350, 351, 352.     
C. Thêm 3 cặp nucleotit ở giữa các bộ ba mã hóa axit amin thứ 350, 351, 352. 
D. Thay thế hoặc mất một cặp nucleotit ở bộ ba mã hóa axit amin thứ 350.
Hướng dẫn giải:
Đáp án: B
P bị mất đi 1 a.a tương ứng với mất 3 nu. Xuất hiện 2 a.a mới ở a.a thứ 350, 351, 352
Mất 3 nu ở giữa các bộ ba mã hóa này.
Ví dụ trình tự nu mã hóa cho 3 a.a số 350,351,352 là:
    5’ AUU AXA XAU 3’
Sau đột biến mất 1 nu ở mỗi bộ ba ta có bộ mã sau đột biến là:
   5’ AUA XXA 3’
Câu 10: Phát biểu nào sau đây là đúng khi nói về đột biến gen?
A. Đột biến xảy ra ở tế bào xoma (đột biến xoma) được nhân lên ở một mô và luôn biểu hiện ở một phần cơ thể.                                    
B. Đột biến gen xảy ra trong những lần nguyên phân đầu tiên của hợp tử (đột biến tiền phôi) thường biểu hiện ra kiểu hình cơ thể            
C. Đột biến xảy ra trong giảm phân hình thành giao tử thường không biểu hiện ra kiểu hình ở thế hệ đầu tiên vì ở trạng thái dị hợp.           
D. Đột biến xoma chỉ có thể di truyền bằng sinh sản sinh dưỡng và nếu là gen lặn sẽ không biểu hiện ra kiểu hình.
Hướng dẫn giải:
Đáp án: D
Câu 11: Gen có 1170 nucleotit và có G = 4A. Sau khi đột biến xảy ra, phân tử protein do gen đột biến tổng hợp bị giảm một axit amin. Khi gen đột biến nhân đôi liên tiếp lần, nhu cầu nucleotit loại A giảm xuống 14 nucleotit. Số liên kết hidro bị hủy qua quá trình trên sẽ là:
A. 11417                            B. 13104                            C. 11466                            D. 11424
Hướng dẫn giải:
Đáp án: A
Giải thích:
Protein do gen đột biến tổng hợp bị giảm một axit amin → mất 3 cặp nucleotit.
Khi gen đột biến nhân đôi liên tiếp 3 lần, nhu cầu nucleotit loại A giảm xuống 14 nucleotit → số nucleotit loại A giảm trong mỗi phân tử ADN là: a.(23 – 1) = 14 → a = 2 → Đột biến mất 2 cặp A – T và 1 cặp G – X.
Gen ban đầu có 1170 nucleotit và có G = 4A → 2A + 2G = 1170, G = 4A → A = 117, G = 468 → Gen đột biến có A = T = 115 và G = X = 467 → Số liên kết hidro = 2A + 3G = 1631.
Số liên kết hidro bị phá hủy trong quá trình trên là: 1631 x (2k – 1) = 1631 x 7 = 11417.
Câu 12: Đột biến gen thường gây hại cho cơ thể mang đột biến vì
A. làm biến đổi cấu trúc gen dẫn tới cơ thể sinh vật không kiểm soát được quá trình tái bản của gen.       
B. làm sai lệch thông tin di truyền dẫn tới làm rối loạn quá trình sinh tổng hợp protein.     
C. làm ngừng trệ quá trình phiên mã, không tổng hợp được protein.                   
D. gen bị biến đổi dẫn tới không truyền đạt được vật chất di truyền qua các thế hệ.
Hướng dẫn giải:
Đáp án: B
Câu 13: Một đột biến làm giảm chiều dài của gen đi 10,2A° và mất 8 liên kết hidro. Khi gen ban đầu và gen đột biến đồng thời nhân đôi 3 lần liên tiếp thì số nucleotit mỗi loại môi trường nội bào cung cấp cho gen đột biến giảm đi so với gen ban đầu là:
A. A=T=8; G=X=16.        B. A=T=16; G=X=8          C. A=T=7; G=X=14         D. A=T=14; G=X=7
Hướng dẫn giải:
Đáp án: C
Chiều dài giảm đi 10,2 A tức là gen bị mất đi 3 cặp Nu
Số liên kết H bị giảm đi 8
Đột biến làm mất đi 1 cặp A-T và 2 cặp G-X
Sau 3 lần nhân đôi số nu môi tường cung cấp đã giảm đi:
A = T = 1.(23 – 1) = 7
G = X = 2.(23 – 1) = 14
Câu 14: Guanin dạng hiếm (G*) kết cặp với timin (T) trong quá trình nhân đôi ADN, tạo nên đột biến điểm dạng
A. thêm một cặp G – X.                                               B. thay thế cặp A – T bằng cặp G – X.         
C. mất một cặp A – T.                                                  D. thay thế cặp G – X bằng cặp A – T.
Hướng dẫn giải:
Đáp án: D
Câu 15: Khi nói về đột biến gen, phát biểu nào sau đây là đúng?
A. Dưới tác động của cùng một tác nhân gây đột biến, với cường độ và liều lượng như nhau thì tần số đột biến ở tất cả các gen là bằng nhau.                                     
B. Khi các bazo nito dạng hiếm xuất hiện trong quá trình nhân đôi ADN thì thường làm phát sinh đột biến gen dạng mất hoặc thêm một cặp nucleotit.                      
C. Trong các dạng đột biến điểm, dạng đột biến thay thế cặp nucleotit thường làm thay đổi ít nhất thành phần axit amin của chuỗi polipeptit do gen đó tổng hợp.   
D. Tất cả các dạng đột biến gen đều có hại cho thể đột biến.
Hướng dẫn giải:
Đáp án: C
Câu 16: Một gen dài 3060A° có tỉ lệ A/G = 4/5. Đột biến xảy ra không làm thay đổi chiều dài của gen nhưng tỉ lệ A/G ≈ 79,28%. Loại đột biến đó là
A. thay thế 2 cặp A – T bằng 2 cặp G – X.                
B. thay thế 1 cặp A – T bằng 1 cặp G – X.                 
C. thay thế 2 nucleotit loại A bằng 2 nucleotit loại G.                                         
D. đảo vị trí cặp A – T và G – X ở 2 bộ ba khác nhau.
Hướng dẫn giải:
Đáp án: A
Giải thích:
Lg = 3060A° → N = 1800 = 2A + 2G.
Mặt khác: A/G = 4/5 → A = T = 400; G = X = 500.
Đột biến không làm thay đổi chiều dài của gen → Đây là dạng đột biến thay thế và không làm thay đổi tổng số nucleotit của gen.
→ Gen đột biến có: 2A + 2G = 1800; A/G ≈ 79,28% → Số nucleotit từng loại của gen đột biến: A = T = 398; G = X = 502 → Đột biến thay thế 2 cặp A – T bằng 2 cặp G – X.
Câu 17: Khi nói về đột biến gen, các phát biểu nào sau đây đúng?
(1) Đột biến thay thế một cặp nucleotit luôn dẫn đến kết thúc sớm quá trình dịch mã.
(2) Đột biến gen tạo ra các alen mới làm phong phú vốn gen của quần thể.
(3) Đột biến điểm là dạng đột biến gen liên quan đến một số cặp nucleotit.
(4) Đột biến gen có thể có lợi, có hại hoặc trung tính đối với thể đột biến.
(5) Mức độ gây hại của alen đột biến phụ thuộc vào tổ hợp gen và điều kiện môi trường.
A. (1), (3) và (5)                B. (1), (2) và (3)                C. (3), (4) và (5)                D. (2), (4) và (5)
Hướng dẫn giải:
Đáp án: D
Câu 18: Một đoạn ADN mạch kép có 4050 liên kết hidro, biết rằng trong đó hàm lượng nucleotit loại T chiếm 15%. Khi gen bị đột biến, tỉ lệ A/G của gen là 43,27%. Nếu chiều dài của gen đột biến không đổi so với gen bình thường thì đột biến gen thuộc dạng
A. thay thế 1 cặp G – X bằng 1 cặp A - T                   B. thay thế 2 cặp G – X bằng 2 cặp A - T     
C. thay thế 3 cặp G – X bằng 3 cặp A - T                   D. thay thế 4 cặp G – X bằng 4 cặp A - T
Hướng dẫn giải:
Đáp án: C
Số nu ban đầu của gen là:
A =T = 450 Nu
G = X = 1050 Nu
Tỉ lệ A/G = 42,85%
Đột biến làm tăng số nu loại A, giảm số nu loại G.
Dựa vào tỉ lệ A/G suy ra loại đột biến là thay thế 3 cặp G-X bằng 3 cặp A-T
Câu 19: Xét các phát biểu sau đây:
(1) Quá trình nhân đôi không theo nguyên tắc bổ sung thì dẫn đến đột biến gen
(2) Đột biến gen trội ở dạng dị hợp cũng được gọi là thể đột biến
(3) Đột biến gen chỉ được phát sinh khi trong môi trường có các tác nhân đột biến
(4) Đột biến gen phát sinh trong pha S của chu kỳ tế bào
(5) Đột biến gen là loại biến dị luôn được di truyền cho thế hệ sau.
Có bao nhiêu phát biểu đúng
A. 2                                    B. 3                                    C. 4                                    D. 1
Hướng dẫn giải:
Đáp án: B
(1) Quá trình nhân đôi không theo nguyên tắc bổ sung thì dẫn đến đột biến gen → đúng
(2) Đột biến gen trội ở dạng dị hợp cũng được gọi là thể đột biến → đúng
(3) Đột biến gen chỉ được phát sinh khi trong môi trường có các tác nhân đột biến → sai, đột biến gen có thể do kết cặp sai trong nhân đôi
(4) Đột biến gen phát sinh trong pha S của chu kỳ tế bào → đúng
(5) Đột biến gen là loại biến dị luôn được di truyền cho thế hệ sau → sai, đột biến gen ở tế bào sinh dưỡng không truyền cho thế hệ sau
Câu 20: Trên phân tử ADN có bazơ nitơ guanin trở thành dạng hiếm thì quá trình nhân đôi xảy ra đột biến thay thế cặp G - X thành cặp A - T. Sơ đồ nào sau đây mô tả đúng cơ chế gây đột biến làm thay thế cặp G - X bằng cặp A - T của bazơ nitơ dạng hiếm?
A. G*-X → G*-T → A-T B. G*-X → G*-A → A-T C. G*-X → T-X → A-T   D. G*-X → A-X → A-T
Hướng dẫn giải:
Đáp án: A
Trên phân tử ADN có bazơ nitơ guanin trở thành dạng hiếm thì quá trình nhân đôi xảy ra đột biến thay thế cặp G - X thành cặp A - T.
Câu 21: Trường hợp gen cấu trúc bị đột biến thêm 1 cặp G - X thì số liên kết hiđrô của gen sẽ
A. Giảm đi 3.                     B. Giảm đi 1.                     C. Tăng thêm 1.                D. Tăng thêm 3.
Hướng dẫn giải:
Đáp án: D
Câu 22: Xét mô hình dạng B của ADN. Gen D dài 510 nm và có A = 10%. Gen D bị đột biến thành alen d. So với gen D, alen d ngắn hơn 1,02 nm và ít hơn 8 liên kết hiđrô. Cho các nhận định sau:
I. Cặp gen Dd nhân đôi 2 lần cần môi trường nội bào cung cấp 7194 nuclêôtit loại guanin.
II. Cặp gen Dd có tổng cộng 599 nuclêôtit loại timin.
III. Cặp gen Dd có tổng cộng 8392 liên kết hiđrô.
IV. Dạng đột biến xảy ra đối với gen trên là mất 1 cặp A - T và mất 2 cặp G - X.
V. Gen D có nhiều liên kết hiđrô hơn gen d.
Số nhận định đúng là:
A. 3.                                   B. 5.                                   C. 2.                                   D. 4
Hướng dẫn giải:
Đáp án: B
D. 2A+2G = 3000; A = 10% → A = T = 300; G = X = 1200
d ngắn hơn 1,02nm = 10,2Å; ít hơn 8 liên kết hidro → mất 3 cặp nu (2G-X; 1A-T) → A = T = 299; G = X = 1198
I. Cặp gen Dd nhân đôi 2 lần cần môi trường nội bào cung cấp 7194 nuclêôtit loại guanine. → đúng, G cung cấp 2 lần nhân đôi của Dd = (1200+1198).(22-1) = 7194.
II. Cặp gen Dd có tổng cộng 599 nuclêôtit loại timin. → đúng, số nu T = 300+299 = 599
III. Cặp gen Dd có tổng cộng 8392 liên kết hiđrô. → đúng, số liên kết hidro của Dd = (2.300+3.1200)+(2.299+3.1198) = 8392
IV. Dạng đột biến xảy ra đối với gen trên là mất 1 cặp A - T và mất 2 cặp G - X. → đúng
V. Gen D có nhiều liên kết hiđrô hơn gen d. → đúng
Câu 23: Khi nói về đột biến gen, phát biểu nào sau đây đúng?
A. Gen đột biến luôn được di truyền cho thế hệ sau. 
B. Đột biến gen có thể xảy ra ở cả tế bào sinh dưỡng và tế bào sinh dục.           
C. Gen đột biến luôn được biểu hiện thành kiểu hình.                                         
D. Đột biến gen cung cấp nguyên liệu thứ cấp cho quá trình tiến hóa.
Hướng dẫn giải:
Đáp án: B
A. Gen đột biến luôn được di truyền cho thế hệ sau. → sai, đột biến xoma không di truyền          
B. Đột biến gen có thể xảy ra ở cả tế bào sinh dưỡng và tế bào sinh dục. → đúng  
C. Gen đột biến luôn được biểu hiện thành kiểu hình. → sai, đột biến gen lặn khi ở trạng thái dị hợp không biểu hiện ra kiểu hình.              
D. Đột biến gen cung cấp nguyên liệu thứ cấp cho quá trình tiến hóa. → sai, đột biến gen cung cấp nguyên liệu sơ cấp cho quá trình tiến hóa.
Câu 24: Có bao nhiêu kết luận sau đây là không đúng khi nói về sự biểu hiện của đột biến gen?
(1) Đột biến gen xảy ra trong những lần nguyên phân đầu tiên của hợp tử có thể di truyền cho thế hệ sau bằng con đường sinh sản vô tính hoặc hữu tính.
(2) Đột biến trội phát sinh trong quá trình giảm phân tạo giao tử sẽ luôn biểu hiện ngay ở thế hệ sau và di truyền được sinh sản hữu tính.
(3) Đột biến gen lặn xảy ra trong tế bào chất của tế bào xôma sẽ không bao giờ được biểu hiện ra kiểu hình và không có khả năng di truyền qua sinh sản hữu tính.
(4) Chỉ có các đột biến gen phát sinh trong quá trình nguyên phân mới có khả năng biểu hiện ra kiểu hình của cơ thể bị xảy ra đột biến.
(5) Thể đột biến phải mang ít nhất là một alen đột biến.
A. 1                                    B. 2                                    C. 3                                    D. 4
Hướng dẫn giải:
Đáp án: B
(1) Đột biến gen xảy ra trong những lần nguyên phân đầu tiên của hợp tử có thể di truyền cho thế hệ sau bằng con đường sinh sản vô tính hoặc hữu tính. → sai, di truyền qua sinh sản hữu tính.
(2) Đột biến trội phát sinh trong quá trình giảm phân tạo giao tử sẽ luôn biểu hiện ngay ở thế hệ sau và di truyền được sinh sản hữu tính. → đúng
(3) Đột biến gen lặn xảy ra trong tế bào chất của tế bào xôma sẽ không bao giờ được biểu hiện ra kiểu hình và không có khả năng di truyền qua sinh sản hữu tính. → sai, đột biến gen lặn có thể biểu hiện ở trạng thái đồng hợp lặn.
(4) Chỉ có các đột biến gen phát sinh trong quá trình nguyên phân mới có khả năng biểu hiện ra kiểu hình của cơ thể bị xảy ra đột biến. → sai.
(5) Thể đột biến phải mang ít nhất là một alen đột biến. → đúng
Câu 25: Một gen có hiệu số phần trăm nuclêôtit loại adenin với một loại nuclêôtit khác là 5% và có số nucleotit loại adenin là 660. Sau khi gen xảy ra đột biến điểm, gen đột biến có chiều dài 408 nm và có tỉ lệ G/A = 82,1%. Dạng đột biến điểm xảy ra với nói gen nói trên là
A. thay thế một cặp A-T bằng một cặp G-X.              B. mất một cặp nucleotit loại A-T.   
C. thêm một cặp nucleotit loại G-X.                           D. thay thế một cặp G-X bằng một cặp A-T.
Hướng dẫn giải:
Đáp án: A
A - G =5% và A +G = 50% → A =27,5%; G =22,5%. Số nuclêôtit loại A = 660 → N =(660 x 100) : 27,5 = 2400 nuclêôtit → G = 540.
L = N/2 x3,4 = 4080Å
Khi bị đột biến gen vẫn giữ chiều dài 4080Å → tổng số nuclêôtit không đổi → Đây là đột biến dạng thay thế.
Gen đột biến có G/A = 82,1%; Gen bình thường: G/A = 81,82%
Tỷ lệ G/A tăng → G tăng, A giảm → Dạng đột biến thay thế cặp A-T bằng cặp G-X.
Câu 26: Cho biết: 5’XXU3’; 5’XXX3’; 5’XXA3’; 5’XXG3’ quy định Pro; 5’AXU3’; 5’AXX3’; 5’XXU 3’; 5’AXA3’; 5’AXG3’ quy định Thr. Một đột biến điểm xảy ra ở giữa alen làm cho alen A Cho biết bộ ba 5'GXU3' quy định tổng hợp axit amin Ala; bộ ba 5'AXU3' quy định tổng hợp axit amin Thr. Một đột biến điểm xảy ra ở giữa alen làm cho alen A thành alen a, trong đó phân tử mARN của alen a bị thay đổi cấu trúc ở một bộ ba dẫn tới axit amin Ala được thay bằng axit amin Thr. Theo lí thuyết, có bao nhiêu phát biểu sau đây đúng?
I. Alen a có thể có chiều dài lớn hơn chiều dài của alen A.
II. Đột biến này có thể là dạng thay thế cặp A-T bằng cặp T-A.
III. Nếu alen A có 150 nuclêôtit loại A thì alen a sẽ có 151 nuclêôtit loại A.
IV. Nếu alen A phiên mã một lần cần môi trường cung cấp 200 nuclêôtit loại X thì alen a phiên mã 2 lần cũng cần môi trường cung cấp 400 nuclêôtit loại X.
A. 2                                    B. 1                                    C. 4                                    D. 3
Hướng dẫn giải:
Đáp án: A
- Theo bài ra, đột biến đã làm cho G của mARN được thay bằng A của ARN. Do đó, đây là đột biến thay thế cặp G-X bằng cặp A-T → I và II sai.
- Vì đột biến thay cặp G-X bằng cặp A-T cho nên alen a sẽ nhiều hơn alen A 1 cặp A-T.
→ Nếu alen A có 150A thì alen a sẽ có 151A.
- Vì đột biến làm cho G của mARN được thay bằng A của mARN nên khi alen A phiên mã 1 lần cần môi trường cung cấp 100X thì alen a phiên mã 2 lần sẽ cần môi trường cung cấp 200X → IV đúng.
Câu 27: Gen A có chiều dài 510nm bị đột biến điểm trở thành alen A. Nếu alen a có 3721 liên kết hiđro thì có bao nhiêu phát biểu sau đây đúng?
I. Nếu alen a có chiều dài 510,34 nm thì chứng tỏ đột biến thêm 1 cặp nuclêôtit.
II. Nếu alen A có tổng số 3720 liên kết hiđro thì chứng tỏ đột biến thay thế cặp A-T bằng cặp G-X.
III. Nếu alen a có 779 số nuclêôtit loại T thì chứng tỏ alen a dài 510 nm.
IV. Nếu alen a có 721 số nuclêôtit loại X thì chứng tỏ đây là đột biến thay thế một cặp nuclêôtit.
A. 1.                                   B. 2.                                   C. 3.                                   D. 4.
Hướng dẫn giải:
Đáp án: D
- I đúng vì alen a dài hơn alen A 0,34nm → Thêm một cặp nuclêôtit.
- II đúng vì nếu alen A có 3720 liên kết hiđro thì chúng đột biến điểm làm tăng 1 liên kết hiđro → Đột biến thay thế cặp A-T bằng cặp G-X.
- III đúng vì alen a có 3721 liên kết hiđro và có 779 T thì suy ra có 721 số nuclêôtit loại G → Tổng số nuclêôtit của alen a là 3000 → Alen a có chiều dài 510nm.
- IV đúng vì alen a có 3721 liên kết hiđro và có 721 X thì suy ra có 779 số nuclêôtit loại A → Tổng số nuclêôtit của alen a là 3000 → Alen A và alen a có tổng số nuclêôtit bằng nhau → Dây là đột biến thay thế một cặp nuclêôtit.
Câu 28: Gen A quy định tổng hợp chuỗi polipeptit có 36 axit amin. Gen A bị đột biến điểm trở thành alen a. Theo lí thuyết, có bao nhiêu phát biểu sau đây đúng?
I. Alen a có thể ít hơn alen A 1 nuclêôtit.
II. Alen a có thể nhiên hơn alen A 3 liên kết hiđro.
III. Chuỗi polipeptit do alen a quy định có thể chỉ có 10 axit amin.
IV. Nếu chuỗi polipeptit do alen a quy định tổng hợp có 50 axit amin thì chứng tỏ đây là đột biến thêm cặp nuclêôtit.
A. 1                                    B. 2                                    C. 3                                    D. 4
Hướng dẫn giải:
Đáp án: B
- Phát biểu I sai vì nếu là đột biến mất cặp thì alen đột biến ít hơn alen A 2 nuclêôtit. Vì gen có cấu trúc mạch kép nên không bao giờ đột biến lại mất 1 nuclêôtit.
- Phát biểu II đúng vì nếu là đột biến thêm 1 cặp G-X thì alen a sẽ tăng thêm 3 liên kết hiđro.
- Phát biểu III đúng vì nếu đột biến làm xuất hiện bộ ba kết thúc ở vị trí cách bộ ba mở đầu 10 bộ ba thì chuỗi polipeptit chỉ có 10 axit amin.
- Phát biểu IV sai vì đột biến mất cặp hoặc thay thế một cặp nuclêôtit cũng có thể làm cho bộ ba kết trở thành bộ ba mã hóa, điều đó sẽ dẫn tới làm tăng số axit amin của chuỗi polipeptit → Khẳng định chắc chắn đây là đột biến thêm cặp là sai.
Câu 29: Gen A dài 306 nm, có 20% nuclêôtit loại Adenin. Gen A bị đột biến thành alen a . Alen a bị đột biến thành alen a1. Alen a1 bị đột biến thành alen a2. Cho biết đột biến chỉ liên quan đến 1 cặp nuclêôtit. Số liên kết hidro của gen A ít hơn so với alen a là 1, nhiều hơn so với số liên kết hidro của alen a1 là 2 và nhiều hơn so với alen a2 là 1. Tính tổng số nuclêôtit của cơ thể mang kiểu gen Aaa1a2?
A. A = T = 1439; G = X = 2160.                                 B. A = T = 1438; G = X = 2160.      
C. A = T = 1436; G = X = 2162.                                 D. A = T = 1441; G = X = 2159.
Hướng dẫn giải:
Đáp án: C
N =(3060 ÷ 3,4) × 2 = 1800; A = 360; G = 540.
Ta có đột biến gen A → a → a1 → a2
Vì đột biến chỉ liên quan tới 1 cặp nuclêôtit.
A ít hơn a 1 liên kết H chứng tỏ gen A bị đột biến thay thế 1 cặp A-T bằng 1 cặp G-X để trở thành gen a.
Số nuclêôtit của a: A = 359, G = 541
A nhiều hơn a1 là 2 liên kết, a sẽ nhiều hơn a1 3 liên kết chứng tỏ gen a bị đột biến mất 1 cặp G-X để trở thành gen a1.
Số nuclêôtit của a1: A = 359; G = 540
A nhiều hơn so với a2 là 1. nên a1 sẽ nhiều hơn a2 1 liên kết → a2 1 bị đột biến thay thế 1 cặp A-T bằng 1 cặp G-X. Số nuclêôtit của a2 là: A = 358. G = 541
Tổng số nuclêôtit của cơ thể : Aaa1a2 là:
A = 360 + 359 + 359 + 358 = 1436.
G = X = 540 + 541+ 540 + 541 =2162
Câu 30: Cho biết bộ ba 5’GXU3’ quy định tổng hợp axit amin Ala; bộ ba 5’AXU3’ quy định tổng hợp axit amin Thr. Một đột biến điểm xảy ra ở giữa alen làm cho alen A thành alen a, trong đó phân tử mARN của alen a bị thay đổi cấu trúc ở một bộ ba dẫn tới axit amin Ala được thay bằng axit amin Thr. Theo lí thuyết, có bao nhiêu phát biểu sau đây đúng?
I. Alen a có thể có chiều dài lớn hơn chiều dài của alen A.
II. Đột biến này có thể là dạng thay thế cặp A-T bằng cặp T-A.
III. Nếu alen A có 150 nuclêôtit loại A thì alen a sẽ có 151 nuclêôtit loại A.
IV. Nếu alen A phiên mã một lần cần môi trường cung cấp 200 nuclêôtit loại X thì alen a phiên mã 2 lần cũng cần môi trường cung cấp 400 nuclêôtit loại X.
A. 1.                                   B. 4.                                   C. 3.                                   D. 2.
Hướng dẫn giải:
Đáp án: D
Theo bài ra, đột biến đã làm làm cho G của mARN được thay bằng A của ARN. Do đó, đây là đột biến thay thế cặp G-X bằng cặp A-T. → I và II
Vì đột biến thay cặp G-X bằng cặp A-T cho nên alen a sẽ nhiều hơn alen A 1 cặp A-T. → Nếu alen A có 150A thì alen a sẽ có
Vì đột biến làm cho G của mARN được thay bằng A của mARN nên khi alen A phiên mã 1 lần cần môi trường cung cấp 100X thì alen a phiên mã 2 lần sẽ cần môi trường cung cấp → IV đúng.
Câu 31: Một gen cấu trúc có 4050 liên kết hiđrô, hiệu số giữa nuclêôtit loại G với loại nuclêôtit khác chiếm 20%. Sau đột biến chiều dài gen không đổi.Cho các phát biểu sau:
I. Gen ban đầu có số luợng từng loại nuclêôtit là A = T = 450, G = X = 1050.
II. Nếu sau đột biến tỉ lệ A/G của gen đột biến bằng 42,90% thì đây là dạng đột biến thay thế 1 cặp G - X bằng 1 cặp A-T.
III. Nếu sau đột biến tỉ lệ A/G bằng 42,72% thì đây là dạng đột biến thay thế 1 cặp A - T bằng 1 cặp G - X.
IV. Dạng đột biến thay thế 1 cặp A - T bằng 1 cặp G - X sẽ làm thay đổi 1 axit amin trong chuỗi polipeptit.
Số phát biểu đúng là
A. 4.                                   B. 3.                                   C. 1.                                   D. 2
Hướng dẫn giải:
Đáp án: D
Xét gen trước đột biến có %G - %A = 20%, ta có hệ phương trình:
Trắc nghiệm Sinh học 12 Bài 1 (có đáp án): Gen, mã di truyền và quá trình nhân đôi ADN
Ta có H = 4050 = N + G = (100% + 35%)N N = 3000 nucleotit
Số lượng nucleotit từng loại của gen là: A - T = 15% x 3000 = 450; G = X = 35% x 3000 =1050 → I đúng
Do chiều dài của gen không thay đổi dau đột biến đột biến thay thế cặp nucleotit.
Nếu thay 1 cặp G-X bằng 1 cặp A-T, ta có tỷ lệ 
Trắc nghiệm Sinh học 12 Bài 1 (có đáp án): Gen, mã di truyền và quá trình nhân đôi ADN  
→ II sai.
Nếu thay 1 cặp A-T bằng 1 cặp G-X, ta có tỷ lệ
 Trắc nghiệm Sinh học 12 Bài 1 (có đáp án): Gen, mã di truyền và quá trình nhân đôi ADN
 → III đúng
IV sai, Dạng đột biến thay thế 1 cặp A-T bằng 1 cặp G-X có thể không làm thay đổi trình tự axit amin trong chuỗi polipeptit (tính thoái hóa của mã di truyền)
Câu 32: Xét gen A ở sinh vật nhân sơ. A bị đột biến thành gen a, gen a hơn A một liên kết hidro. Biết A và a có cùng kích thước, vùng mã hóa của chúng mã hóa cho một chuỗi polypeptide hoàn chỉnh có 298 axitamin. Có bao nhiêu ý sau đây đúng khi nói về A và a?
I. Số nuclêôtít tại vùng mã hóa của gen a là 1800.
II. A và a là hai gen alen, cùng quy định một tính trạng.
III. Đột biến hình thành a là đột biến mất một cặp nucleotide.
IV. Chuỗi polypeptide do a hai gen mã hóa luôn khác nhau về trình tự axitamin.
A. 3                                    B. 2                                    C. 4                                    D. 1
Hướng dẫn giải:
Đáp án: B
Hai gen có cùng kích thước, gen a có nhiều hơn gen A 1 liên kết hidro → đột biến thay thế 1 cặp A-T bằng 1 cặp G-X
Có 298 axit amin trong chuỗi polipeptit hoàn chỉnh → số N của gen là: N = 1800
Xét các phát biểu
I đúng
II đúng
III sai
IV sai, có thể đột biến này làm thay codon này bằng codon khác nhưng vẫn mã hoá a.a đó nên trình tự a.a không thay đổi (tính thoái hoá của mã di truyền)
Câu 33: Alen A ở vi khuẩn E. coli bị đột biến điểm thành alen a. Theo lí thuyết, có bao nhiêu phát biểu sau đây đúng?
I. Alen a và alen A có thể có số lượng nuclêôtit bằng nhau.
II. Nếu đột biến mất cặp nuclêôtit thì alen a và alen A có chiều dài bằng nhau.
III. Chuỗi pôlipeptit do alen a và chuỗi pôlipeptit do alen A quy định có thể có trình tự axit amin giống nhau.
IV. Nếu đột biến thay thế một cặp nuclêôtit ở vị trí giữa gen thì có thể làm thay đổi toàn bộ các bộ ba từ vị trí xảy ra đột biến cho đến cuối gen.
A. 3.                                   B. 4.                                   C. 1.                                   D. 2.
Hướng dẫn giải:
Đáp án: D
Ý đúng là III, đột biến thay thế có thể không làm thay đổi chuỗi polipeptit tạo thành
Ý I, II không thể chắc chắn đúng vì đột biến mất, thêm sẽ làm thay đổi số lượng nuclêôtit và chiều dài gen
Ý IV sai vì đột biến thay thế không làm thay đổi các bộ ba còn lại trên gen
Câu 34: Ở một loài sinh vật, xét một locut gồm 2 alen A và a, trong đó alen A là một đoạn ADN dài 306nm và có 2338 liên kết hiđrô, alen a là sản phẩm đột biến từ alen A. Một tế bào xoma chứa cặp alen Aa tiến hành nguyên phân liên tiếp 3 lần, số nucleotit cần thiết cho quá trình tái bản của các alen là 5061A và 7532G. Cho kết luận sau:
I. Gen A có chiều dài lớn hơn gen a
II. Gen A có G = X = 538; A = T =362.
III. Gen a có A = T = 361; G = X = 539
IV. Đây là dạng đột biến thay thế một cặp A – T bằng một cặp G – X
Số kết luận đúng là
A. 1                                    B. 3                                    C. 4                                    D. 2
Hướng dẫn giải:
Đáp án: D
Xét gen A có:
Tổng số nucleotit là :
Số nucleotit từng loại là: (2) đúng
Xét cặp gen Aa tái bản 3 lần thì cần môi trường cung cấp 5061A và 7532 G
=> Số nucleotit từng loại trong gen a là:
A = T = 5061 : (23 - 1) - 362 = 361.
G = X = 7532 : (23 - 1) - 538 = 538.
=>(3) sai,
(4) sai, (1) đúng.
Câu 35: Alen A ở vi khuẩn E.coli đột biến thành alen a. Biết rằng alen A ít hơn alen a 2 liên kết hidro. Theo lí thuyết, có bao nhiêu phát biểu sau đây đúng?
1. Nếu alen a và alen A có số lượng nuclêôtit bằng nhau thì đây là đột biến điểm.
2. Nếu alen a và alen A có chiều dài bằng nhau và alen A có 500 nucleotit loại G thì alen a có 498 nucleotit loại X.
3. Chuỗi pôlipeptit do alen a và chuỗi pôlipeptit do alen A quy định có thể có trình tự axit amin giống nhau.
4. Nếu alen A có 400 nucleotit loại T và 500 nucleotit loại G thì alen a có thể có chiều dài 306,34nm.
A. 2                                    B. 3                                    C. 4                                    D. 1
Hướng dẫn giải:
Đáp án: A
I sai. Vì đột biến này làm tăng 2 liên kết hidro nên nếu là đột biến không làm thay đổi tổng số nucleotit thì chứng tỏ đây là đột biến thay 2 cặp A-T bằng 2 cặp G-X. → Không phải là đột biến điểm.
II sai. Vì nếu 2 alen có chiều dài bằng nhau thì chứng tỏ đây là đột biến thay thế 2 cặp A-T bằng 2 cặp G-X→ số nucleotit loại X của alen a = số nucleotit loại X của alen A + 2 = 500 + 2 = 502.
III đúng. Vì nếu đột biến thay thế 2 cặp A-T bằng 2 cặp G-X thì có thể sẽ không làm thay đổi axit amin.
IV đúng. Vì alen A có tổng số 1800 nucleotit nên có chiều dài = 306nm. Nếu đột biến này là đột biến thêm 1 cặp nucleotit thì chứng tỏ sẽ làm tăng chiều dài của alen ban đầu lên 0,34nm.
→ Alen a có chiều dài 306nm + 0,34 = 306,34nm.
Câu 36: Cho đoạn ADN trên mạnh khuôn ở người và một đoạn ARN của một loài vi rút gây suy giảm miễn dịch.
Đoạn ADN: 3’ XXGTA (1) XAGGXGAAAT (2) TGGTTAGGGA (3) GATTTAXT 5’
Đoạn ARN: 5’ AUGUAUGGUUAAA 3’
Bình thường đoạn ADN ở người phiên mã rồi dịch mã sẽ tạo ra chuỗi polipeptit tổng hợp bạch cầu. Khi virut xâm nhập vào cơ thể, virut sẽ tiến hành phiên mã ngược và chèn vào một trong 3 kí hiệu (1), (2), (3) trên đoạn ADN, gây đột biến mất hoặc thêm một cặp nuclêôtit ảnh hưởng đến chức năng bạch cầu. Biến exon chiếm 2 bộ mã di truyền còn intron chiếm một bộ mã di truyền, quá trình trưởng thành của mARN không có sự hoán vị gữa các exon. Có bao nhiêu nhận định sau đây đúng khi nói về đoạn thông tin trên?
I. Các bộ mã di truyền trong đoạn ADN của người này thể hiện tính thái hóa.
II. Trường hợp đoạn ADN của virut sau khi phiên mã ngược chèn vào vị trí (3) trên ADN của người thì chuỗi pôlipeptít hoàn chỉnh được tổng hợp sẽ có 7 axit amin.
III. Trong 3 trường hợp bị vi rút xâm nhập và trường hợp bình thường pôlipeptít hoàn chỉnh có số axit amin ít nhất có thể rơi vào trường hợp đoạn ADN của vi rút chèn vào vị trí (1) trên ADN của người.
IV. Bình thường, chuỗi polipeptit hoàn chỉnh tổng hợp bạch cầu sẽ có 8 axit amin.
A. 1                                    B. 2                                    C. 3                                    D. 4
Hướng dẫn giải:
Đáp án: C
Đoạn ARN của virut phiên mã ngược thành: 3’ TAXATAXXAAXXX 5’
I. Đúng. Bình thường: ADN: 3’ XXGTAXAGGXGAAATTGGTTAGGGAGATTTAXT 5’
→ 5’ GGXAUGUXXGXUUUAAUUAAUXXXUXUAAAUGA 3’
Trình tự các axitamin: Met – Ser – Ala – Leu – Thr – Asn – Pro – Ser – Lys
2 bộ ba cùng mã hóa cho axit amin Ser → tính thoái hóa
II. sai. Chèn vào vị trí (3)
XXGTAX AGG XGA AAT TGG TTA GGG ATA XAT AXX AAX XXG ATT TAXT
Bắt đầu từ bộ ba TAX, kết thúc ở bộ ba ATT chuỗi polipeptit hoàn chỉnh có 11 axitamin
III. đúng
+ Bình thường: ADN: 3’ XXGTAX AGG XGA AAT TGG TTA GGG AGA TTT AXT 5’
Bắt đầu từ bộ ba TAX, kết thúc ở bộ ba AXT, chuỗi polipeptit hoàn chỉnh có 8 axit amin.
+ Chèn vào vị trí (1)
XXGTATAX ATA XXA AXX XXA GGX GAA ATTGGTTAGGGA GATTTAXT
Bắt đầu từ bộ ba TAX, kết thúc ở bộ ba ATT chuỗi polipeptit hoàn chỉnh có 6 axitamin
+ Chèn vào vị trí (2)
XXGTAX AGG XGA AAT TAX ATA XXA AXX XTG GTT AGG GAG ATT TAXT
Chưa xuất hiện bộ ba kết thúc, chuỗi polipeptit hoàn chỉnh có hơn 13 axit amin
+ Chèn vào ví trí (3) có 11 axitamin
IV. đúng
Bình thường: ADN: 3’ XXGTAX AGG XGA AAT TGG TTA GGG AGA TTT AXT 5’
Bắt đầu từ bộ ba TAX, kết thúc ở bộ ba AXT, chuỗi polipeptit hoàn chỉnh tổng hợp bạch cầu sẽ có 8 axit amin.
Câu 37: Alen B ở sinh vật nhân sơ bị đột biến thay thế một cặp nuclêôtit ở giữa vùng mã hóa của gen tạo thành alen b, làm cho côđon 5’UGG3’ trên mARN được phiên mã từ alen B trở thành côđon 5’UGA3’ trên mARN được phiên mã từ alen b. Trong các dự đoán sau đây, có bao nhiêu dự đoán đúng?
I. Alen B ít hơn alen b một liên kết hidrô.
II. Chuỗi pôlipeptit do alen B quy định tổng hợp khác với chuỗi pôlipeptit do alen b quy định tổng hợp 1 axit amin.
II. Đột biến xảy ra có thể làm thay đổi chức năng của prôtêin và biểu hiện ra ngay thành kiểu hình ở cơ thể sinh vật.
IV. Chuỗi pôlipeptit do alen B quy định tổng hợp dài hơn chuỗi pôlipeptit do alen b quy định tổng hợp.
A. 4                                    B. 1                                    C. 3                                    D. 2
Hướng dẫn giải:
Đáp án: D
Đột biến thay 1 cặp G-X bằng 1 cặp A-T làm xuất hiện mã kết thúc.
I sai, alen B nhiều hơn alen b 1 liên kết hidro.
II sai, so với chuỗi polipeptit của gen B thì chuỗi polipeptit của gen b có số lượng axit amin ít hơn, mất tất cả axit amin từ điểm đột biến.
III đúng.
IV đúng
Câu 38: Một gen cấu trúc (B) dài 4080Å, có tỉ lệ A/G = 3/2. Gen này được xử lí bằng hóa chất 5-BU, qua nhân đôi đã tạo ra một alen đột biến (b). Số lượng nuclêôtit từng loại của alen (b) là
A. A = T = 479; G = X = 721.                                     B. A = T = 721; G = X = 479.          
C. A = T = 719; G = X = 481.                                     D. A = T = 481; G = X = 719.
Hướng dẫn giải:
Đáp án: C
NB = 4080×2 : 3,4 = 2400 nucleotit = 2A+2G
Ta có A/G=3/2
Giải hệ phương trình:
Trắc nghiệm Sinh học 12 Bài 1 (có đáp án): Gen, mã di truyền và quá trình nhân đôi ADN
Gen này được xử lí bằng hóa chất 5-BU sẽ làm thay 1 cặp A-T bằng 1 cặp G-X.
Vậy gen b: A = T = 719; G = X = 481.
Câu 39: Ở sinh vật nhân sơ, xét gen B dài 0,408µm và có A = G. Trên mạch 1 của gen có A = 120, mạch 2 của gen có X = 20% tổng số nucleotit của mạch. Gen B bị đột biến thành alen b, alen b tự nhân đôi 2 lần liên tiếp thì môi trường nội bào cần cung cấp 7194 nucleotit tự do và số liên kết hidro trong các gen con thu được là 11988. Theo lí thuyết, có bao nhiêu phát biểu sau đây đúng về gen B?
I. Đột biến đã xảy ra với gen B là mất 1 cặp G-X.
II. Tổng số nucleotit của gen B là 2400.
III. Mạch 1 của gen B có A = 120; T = 360; G = 240; X = 480.
IV. Dạng đột biến trên chỉ làm thay đổi 1 bộ ba.
A. 4                                    B. 2                                    C. 3                                    D. 1
Hướng dẫn giải:
Đáp án: B
Gen B.
Trắc nghiệm Sinh học 12 Bài 1 (có đáp án): Gen, mã di truyền và quá trình nhân đôi ADN
Mạch 1 có A1 = 120=T2 →A2 = T1 = 600 – 120 = 480
Mạch 2 có X2 = 20%NB/2 =240 = G1 → X1=G2 = 600 – 240 = 380
Gen b có tổng số nucleotit là NB
Gen b nhân đôi 2 lần
Ta có Nmt = Nb×(22 – 1)= 7194 → Nb = 2398
Số liên kết hidro trong mỗi gen con là : Hb = H : 22 = 2997
Số nucleotit từng loại có thể tính theo hệ phương trình:
Trắc nghiệm Sinh học 12 Bài 1 (có đáp án): Gen, mã di truyền và quá trình nhân đôi ADN
→ Đột biến mất 1 cặp G-X
I đúng
II đúng
III sai, mạch 1 của gen B. A1 = 120; T1 = 480; G1 = 240; X1 = 380
IV sai, đột biến trên làm thay đổi các bộ ba từ điểm đột biến.
Câu 40: Alen A ở vi khuẩn E.coli bị đột biến thành alen a. Theo lí thuyết, có bao nhiêu phát biểu sau đây đúng?
I. Nếu là đột biến điểm thì hai alen này chỉ khác nhau 1 cặp nuclêôtit.
II. Nếu alen a và alen A có chiều dài bằng nhau thì đây là đột biến điểm.
III. Nếu đột biến thay thế 1 cặp nuclêôtit thì chuỗi pôlipeptit do alen a quy định tổng hợp và chuỗi pôlipeptit do alen A quy định tổng hợp có tổng số aa bằng nhau.
IV. Nếu là đột biến điểm và alen a nhiều hơn 3 liên kết hidro thì đây là đột biến thêm 1 cặp G-X.
A. 2                                    B. 1                                    C. 4                                    D. 3
Hướng dẫn giải:
Đáp án: B
I đúng, đột biến điểm chỉ liên quan tới 1 cặp nucleotit
II sai, nếu 2 gen có chiều dài bằng nhau thì đây là đột biến thay thế cặp nucleotit.
III sai, nếu đột biến làm xuất hiện bộ ba kết thúc sớm thì số lượng axit amin của chuỗi polipeptit của gen đột biến ít hơn.
IV sai, nếu thêm 1cặp G-X thì số liên kết hidro tăng 2.
Câu 41: Một gen có chiều dài 4080 A và có số A=2G bị đột biến điểm. Gen đột biến có chiều dài không đổi và nhiều hơn gen ban đầu 1 liên kết hiđrô. Khi gen đột biến nhân đôi bình thường 5 lền liên tiếp. Số nuclêôtit loại G mà môi trưòng cung cấp cho quá trình nhân đôi đó là
A. 12431.                           B. 12396.                           C. 24769.                           D. 12400.
Hướng dẫn giải:
Đáp án: A
Số nucleotit của 2 gen là:
Trắc nghiệm Sinh học 12 Bài 1 (có đáp án): Gen, mã di truyền và quá trình nhân đôi ADN
Gen bình thường:
Trắc nghiệm Sinh học 12 Bài 1 (có đáp án): Gen, mã di truyền và quá trình nhân đôi ADN
Gen đột biến có chiều dài bằng gen bình thường nhưng có nhiều hơn gen ban đầu 1 liên kết hiđrô → đột biến thay 1 cặp A-T bằng 1 cặp G-X.
Gen đột biến có G=401
Khi gen đột biến nhân đôi bình thường 5 lền liên tiếp. Số nuclêôtit loại G mà môi trưòng cung cấp cho quá trình nhân đôi đó là: Gmt =G×(25 – 1) = 12431
Câu 42: Gen M có 4050 liên kết hidrô và có hiệu số giữa tỉ lệ phần trăm nuclêôtit loại G và nucleôtit không bổ sung với nó là 20%. Gen M bị đột biến điểm thành gen m. Một tế bào chứa cặp gen Mm nguyên phân bình thường liên tiếp hai lần cần môi trường nội bào cung cấp 2703 nuclêôtit loại T và 6297 nuclêôtit loại X. Biết rằng quá trình nguyên phân diễn ra bình thường. Theo lí thuyết, có bao nhiêu phát biểu sau đúng?
I. Dạng đột biến xảy ra đối với gen M là đột biến thay thế một cặp G - X bằng một cặp A - T.
II. Chiều dài của gen m là 5100Å.
III. Số nuclêôtit mỗi loại của gen m là A= T= 499, G =X = 1051.
IIV. Số chu kì xoắn của gen M nhiều hơn gen m.
A. 4                                    B. 2                                    C. 3                                    D. 1
Hướng dẫn giải:
Đáp án: B
Gen M:
Trắc nghiệm Sinh học 12 Bài 1 (có đáp án): Gen, mã di truyền và quá trình nhân đôi ADN
Ta có N = 2A +2G = 100% →H=2A+3G= 135%N → N= 3000 nucleotit
→A=T=450; G=X=1050
Cặp gen Mm :
Tmt = (TM + Tm)×(22 – 1)= 2703 → Tm =451
Xmx = (XM + Xm)×(22 – 1)= 6297 → Xm =1049
→ Đột biến thay 1 cặp A-T bằng 1 cặp G-X → Chiều dài gen không đổi : L= 3,4×N/2=5100Å
Xét các phát biểu :
I sai
II đúng.
III đúng
IV sai, chu kỳ xoắn bằng nhau.
Câu 43: Một gen có 5000 nucleotit và có loại A chiếm 10% bị đột biến điểm. Gen đột biến có chiều dài là 8496,6Å và có 6998 liên kết hiđrô. Đây là dạng đột biến
A. mất một cặp G - X.                                                  B. Mất một cặp A - T.      
C. Thay thế 1 cặp G –X bằng 1 cặp A-T                     D. Thay thế 1 cặp A –T bằng 1 cặp G-X
Hướng dẫn giải:
Đáp án: B
Gen bình thường:
N =5000; A=10% = T; G=X=40%
H= 2A+3G= 140%N =7000 nucleotit;
L = 8500
Gen đột biến:
L = 8496,6Å; → N = 4998; H= 6998
→ Số nucleotit giảm 2 →mất 1 cặp nucleotit; số H giảm 2 →mất 1 cặp A-T
Câu 44: Alen B dài 221 nm và có 1669 liên kết hiđrô, alen B bị đột biến thành alen b Từ một tế bào chứa cặp gen Bb qua hai lần nguyên phân bình thường, môi trường nội bào đã cung cấp cho quá trình nhân đôi của cặp gen này 1689 nuclêôtit loại timin và 2211 nuclêôtit loại xitôzin. Trong các kết luận sau, có bao nhiêu kết luận đúng?
(1) Dạng đột biến đã xảy ra với gen B là đột biến thay thế 1 cặp G - X bằng 1 cặp A - T.
(2) Tổng số liên kết hiđrô của gen b là 1669 liên kết.
(3) Số nuclêôtit từng loại của gen b là A = T = 282; G = X = 368.
(4) Tổng số nuclêôtit của gen b là 1300 nuclêôtit.
A. 2                                    B. 1                                    C. 3                                    D. 4
Hướng dẫn giải:
Đáp án: C
NB = 2L/3,4 =1300
HB = 2AB + 3GB = 1669
Ta có hệ phương trình
Trắc nghiệm Sinh học 12 Bài 1 (có đáp án): Gen, mã di truyền và quá trình nhân đôi ADN
gen Bb nguyên phân bình thường hai lần liên tiếp, môi trường nội bào đã cung cấp 1689 nuclêôtit loại timin và 2211 nuclêôtit loại xitôzin
Tmt = (TB + Tb)(22 – 1) = 1689 → Tb = 282
Xmt = (XB + Xb)(22 – 1) = 2211 → Xb = 368
Dạng đột biến này là thay thế một cặp G-X bằng một cặp A-T.
(1) đúng
(2) sai, Hb = 2Tb + 3Xb = 1668
(3) đúng
(4) đúng, Nb = 2Tb + 2Xb = 1300.
Câu 45: Xét một gen b trong nhân của tế bào nhân thực, có chiều dài 5100Å và có tỉ lệ nucleotit loại G chiếm 20% tổng số nucleotit của gen. Trong cấu trúc của gen b có một loại bazơ loại G bị thay đổi cấu trúc trở thành dạng hiếm và làm phát sinh đột biến gen b thành      B. Khi gen b nhân đôi một số lần và đã tạo ra các gen con, tổng số nucleotit loại G trong các gen con không bị thay đổi cấu trúc là 76800. Cho biết đột biến phát sinh ngay lần nhân đôi thứ nhất của gen. Có bao nhiêu kết luận sau đây đúng?
I. Gen đột biến B có chiều dài bằng gen b.
II. Gen b đã nhân đôi 7 lần.
III. Tổng số nucleotit loại X trong các gen đột biến B là 76073.
IV. Tổng số nucleotit loại A trong các gen đột biến B là 114427.
A. 4                                    B. 3                                    C. 1                                    D. 2
Hướng dẫn giải:
Đáp án: B
Số nucleotit của gen b:
 Trắc nghiệm Sinh học 12 Bài 1 (có đáp án): Gen, mã di truyền và quá trình nhân đôi ADN  
→ Gb= 3000×0,2 =600 → A=T=900
Đột biến do nucleotit G* sẽ gây ra đột biến thay thế 1 cặp nucleotit: G-X bằng T-A
Gen B. A=T=901; G=X=599
Đột biến xảy ra ở lần nhân đôi thứ nhất, trải qua 2 lần nhân đôi tạo 3 gen bình thường; 1 gen đột biến
I đúng, do đây là đột biến thay thế cặp nucleotit
II sai, gọi n là số lần nhân đôi của gen b, số gen bình thường tạo ra là 2×2n - 2; số gen đột biến 2n-1 -1
Số nucleotit loại G ở các gen bình thường: 600 ×2×2n - 2 = 78600 →n= 8
III đúng, số nucleotit loại X trong các gen B là: 599×(2n-1 -1) =76073
III đúng. số nucleotit loại A trong các gen B là: 901×(2n-1 -1) =114427
Câu 46: Gen A ở vi khuẩn E. coli quy định tổng hợp một loại prôtêin có 98 axit amin. Gen này bị đột biến mất cặp nuclêôtit số 291, 294, 297 và tạo ra gen a. Nếu cho rằng các bộ ba khác nhau quy định các loại axit amin khác nhau.
Có bao nhiêu phát biểu sau đây đúng khi so sánh prôtêin do gen a tổng hợp (prôtêin đột biến) và prôtêin do gen A tổng hợp (prôtêin bình thường) ?
I. Prôtêin đột biến kém prôtêin bình thường một axit amin, có axit amin thứ 92 và 93 khác prôtêin bình thường.
II. Prôtêin đột biến kém prôtêin bình thường hai axit amin và có hai axit amin đầu tiên khác prôtêin bình thường.
III. Prôtêin đột biến kém prôtêin bình thường hai axit amin, có axit amin thứ 3 và 4 khác prôtêin bình thường.
IV. Prôtêin đột biến kém prôtêin bình thường một axit amin và có hai axit amin cuối cùng khác prôtêin bình thường.
A. 4                                    B. 1                                    C. 2                                    D. 3
Hướng dẫn giải:
Đáp án: B
Mất 3 cặp nucleotit → làm mất 1 axit amin (1 axit amin được quy định bởi 1 bộ 3 nucleotit) → II, III sai.
Gen bình thường tổng hợp protein có 98 axit amin → số bộ ba là 98 +2 = 100 (1 bộ ba kết thúc; 1 bộ ba mở đầu)
Vị trí cặp nucleotit 297 thuộc bộ ba 99; là axit amin cuối cùng.
Vậy sẽ có hai axit amin cuối cùng khác prôtêin bình thường. → I sai; IV đúng
Câu 47: Trong tế bào của một loài thực vật lưỡng bội, xét 6 gen A, B, C, D, E, F. Trong đó gen A và B cùng nằm trên NST số 1 , gen C và D cùng nằm trên NST số 2, gen E nằm trong ti thể, gen F nằm trong lục lạp. Biết không xảy ra đột biến. Theo lý thuyết, có bao nhiêu phát biểu sau đây đúng ?
I. Nếu gen C nhân đôi 3 lần thì gen D cũng nhân đôi 3 lần
II. Nếu gen A phiên mã 20 lần thì gen B cũng phiên mã 20 lần
III. Nếu đột biến thể một xảy ra ở cặp NST số 2 thì gen C chỉ có 1 bản sao
IV. Khi gen F nhân đôi 1 số lần, nếu có chất 5BU thấm vào tế bào thì có thể phát sinh đột biến gen dạng thay thế cặp A-T bằng cặp G-X
A. 1                                    B. 2                                    C. 4                                    D. 3
Hướng dẫn giải:
Đáp án: D
I đúng, vì 2 gen này được nhân đôi khi NST nhân đôi
II sai, phiên mã dựa vào nhu cầu của tế bào với sản phầm của 2 gen đó
III đúng
IV đúng
Câu 48: Cho biết: 5’XXU3’; 5’XXX3’; 5’XXA3’; 5’XXG3’ quy định Pro; 5’AXU3’; 5’AXX3’; 5’XXU 3’; 5’AXA3’; 5’AXG3’ quy định Thr. Một đột biến điểm xảy ra ở giữa alen làm cho alen A thành alen a, trong đó chuỗi mARN của alen a bị thay đổi cấu trúc ở một bộ ba dẫn tới axit amin Pro được thay bằng axit amin Thr. Theo lí thuyết, có bao nhiêu phát biểu sau đây đúng?
1. Alen a có thể có chiều dài lớn hơn chiều dài của alen A.
2. Đột biến thay thể cặp G-X bằng cặp T-A đã làm cho alen A thành alen a.
3. Nếu alen A có 200 T thì alen a sẽ có 201 A.
4. Nếu alen A phiên mã một lần cần môi trường cung cấp 99 X thì alen a phiên mã 1 lần cũng cần môi trường cung cấp 100X.
A. 2                                    B. 4                                    C. 1                                    D. 3
Hướng dẫn giải:
Đáp án: A
Pro : 5’XXU3’; 5’XXX3’; 5’XXA3’; 5’XXG3’
Thr : 5’AXU3’; 5’AXX3’; 5’XXU3’; 5’AXA3’; 5’AXG3’
Đột biến có thể xảy ra là G-X thành A-T; T-A thành A-T; X-G thành T-A
(1) sai, đây là đột biến thay thế nên không thay đổi chiều dài của gen
(2) đúng
(3) đúng
(4) sai
Câu 49: Gen B ở sinh vật nhân sơ có trình tự nuclêôtit sau:
Trắc nghiệm Sinh học 12 Bài 1 (có đáp án): Gen, mã di truyền và quá trình nhân đôi ADN
(1) Đột biến thay thế cặp nuclêôtit G - X ở vị trí 88 bằng cặp nuclêôtit A - T tạo ra alen mới quy định tổng hợp chuỗi pôlipeptit ngắn hơn so với chuỗi pôlipeptit do gen B quy định tổng hợp. Biết rằng axit amin valin chỉ được mã hóa bởi 4 triplet là: 3’ XAA 5’; 3’XAG 5’; 3’ XAT 5’; 3’ XAX 5’ và chuỗi pôlipeptit do gen B quy định tổng hợp có 31 axit amin. Căn cứ vào các dữ liệu trên, hãy cho biết có những dự đoán nào sau đây đúng?
(2) Đột biến thay thế 1 cặp nuclêôtit ở vị trí 63 tạo ra alen mới quy định tổng hợp chuỗi pôlipeptit giống với chuỗi pôlipeptit do gen B quy định tổng hợp.
(3) Đột biến mất 1 cặp nuclêôtit ở vị trí 64 tạo ra alen mới quy định tổng hợp chuỗi pôlipeptit có thành phần axit amin thay đổi từ axit amin thứ 2 đến axit amin thứ 21 so với chuỗi pôlipeptit do gen B quy định tổng hợp.
(4) Đột biến thay thế 1 cặp nuclêôtit ở vị trí 91 tạo ra alen mới quy định tổng hợp chuỗi pôlipeptit thay đổi 1 axit amin so với chuỗi pôlipeptit do gen B quy định tổng hợp.
A. (3), (4).                         B. (1), (2), (3).                   C. (1), (2), (4).                   D. (1), (2).
Hướng dẫn giải:
Đáp án: C
(1) Đúng, do tạo ra mã kết thúc UGA
(2) Đúng do vị trí nu thứ 3 của một số bộ ba bất kể là loại nu nào trong 4 loại nu A,U,G,X thì vẫn mã hóa 1 loại axit amin. Đây là do tính thoái hóa mã di truyền
(3) Sai, xảy ra đột biến dịch khung, toàn bộ các axit amin bắt đầu kể từ vị trí đột biến đều bị thay đổi
(4) Đúng do 2 vị trí nu đầu tiên là vị trí đặc hiệu, thay thế cặp nu khác sẽ mã hóa axit amin khác
Câu 50: B dài 221 nm và có 1669 liên kết hiđrô, alen B bị đột biến thành alen b. Từ một tế bào chứa cặp gen Bb qua hai lần nguyên phân bình thường, môi trường nội bào đã cung cấp cho quá trình nhân đôi của cặp gen này 1689 nuclêôtit loại timin và 2211 nuclêôtit loại xitôzin. Dạng đột biến đã xảy ra với alen B là
A. mất một cặp A-T                                                     B. thay thế một cặp A-T bằng một cặp G-X.
C. thay thế một cặp G-X bằng một cặp A-T.              D. mất một cặp G-X.
Hướng dẫn giải:
Đáp án: C
NB = 2L/3,4 =1300
HB = 2AB + 3GB = 1669
Ta có hệ phương trình
Trắc nghiệm Sinh học 12 Bài 1 (có đáp án): Gen, mã di truyền và quá trình nhân đôi ADN
gen Bb nguyên phân bình thường hai lần liên tiếp, môi trường nội bào đã cung cấp 1689 nuclêôtit loại timin và 2211 nuclêôtit loại xitôzin
Tmt = (TB + Tb)(22 – 1) = 1689 → Tb = 282
Xmt = (XB + Xb)(22 – 1) = 2211 → Xb = 368
Dạng đột biến này là thay thế một cặp G-X bằng một cặp A-T.
 

Tổng số điểm của bài viết là: 5 trong 1 đánh giá

Xếp hạng: 5 - 1 phiếu bầu
Click để đánh giá bài viết

  Ý kiến bạn đọc

Những tin mới hơn

Những tin cũ hơn

DANH MỤC TÀI LIỆU
Bạn đã không sử dụng Site, Bấm vào đây để duy trì trạng thái đăng nhập. Thời gian chờ: 60 giây